Protocol 20077: End Point Analysis Assay - Trem2<em1Adiuj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:48487850+48487972 123bp ACTTATGACGCCTTGAAGCA CTTCTTCAGGAAGGCCAGCA

CACTGGGGGAGAC(g/a)CAA(g/a)GC(c/a)TGGTGTCGGCAGCT

Mut = A, A, A

WT= G, G, C

 

Sequence

SEQ

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
29795 ACT TAT GAC GCC TTG AAG CA Forward A
29796 CTT CTT CAG GAA GGC CAG CA Reverse A
29799 Fluorophore-1 AGA CGC AAG GCC TGG TG Quencher-1 WT Probe
29800 Fluorophore-2 AGA CAC AAA GCA TGG TGT CG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
29795 0.40 uM
29796 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
034454 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Plcg2em3Adiuj Appem1Adiuj Trem2em1Adiuj/J
028709 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
031668 B6(SJL)-Cr2tm1(CR2,CR1)How Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
030320 B6.Cg-Apoetm1.1(APOE*4)Adiuj Abca7em1Adiuj Trem2em1Adiuj/J
030283 B6.Cg-Apoetm1.1(APOE*4)Adiuj Abca7em2Adiuj Trem2em1Adiuj/J
033869 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj Bin1em1Adiuj/J
030670 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J
031722 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem2Adiuj Trem2em1Adiuj/J
030673 B6.Cg-Apoetm1.1(APOE*4)Adiuj Ceacam1em1Adiuj Trem2em1Adiuj/J
031944 B6.Cg-Apoetm1.1(APOE*4)Adiuj Clasp2em1Adiuj Trem2em1Adiuj/J
030304 B6.Cg-Apoetm1.1(APOE*4)Adiuj Il1rapem1Adiuj Trem2em1Adiuj/J
033541 B6.Cg-Apoetm1.1(APOE*4)Adiuj Il34em1Adiuj Appem1Adiuj Trem2em1Adiuj/J
033770 B6.Cg-Apoetm1.1(APOE*4)Adiuj Meox2tm1(cre)Sor Trem2em1Adiuj/J
030674 B6.Cg-Apoetm1.1(APOE*4)Adiuj Plcg2em3Adiuj Trem2em1Adiuj/J
033867 B6.Cg-Apoetm1.1(APOE*4)Adiuj Ptprbem1Adiuj Appem1Adiuj Trem2em1Adiuj/J
031942 B6.Cg-Apoetm1.1(APOE*4)Adiuj Snx1em1Adiuj Trem2em1Adiuj/J
031940 B6.Cg-Apoetm1.1(APOE*4)Adiuj Sorl1em1Adiuj Trem2em1Adiuj/J
031938 B6.Cg-Kif21bem1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
030922 B6.Cg-Mthfrem1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
031946 B6;SJL-Apoetm1.1(APOE*4)Adiuj Erc2em1Adiuj Trem2em1Adiuj/J
031950 B6;SJL-Apoetm1.1(APOE*4)Adiuj Mtmr4em1Adiuj Trem2em1Adiuj/J
030771 B6;SJL-Apoetm1.1(APOE*4)Adiuj Plcg2em1Msasn Trem2em1Adiuj/J
031952 B6;SJL-Apoetm1.1(APOE*4)Adiuj Shc2em1Adiuj Trem2em1Adiuj/J
031948 B6;SJL-Slc6a17em1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
027918 C57BL/6J-Trem2em1Adiuj/J
25 strains use this protocol