Genotyping Protocols Database
Protocol 34845: Standard PCR Assay - Cr2<tm1(CR2,CR1)How>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 229 bp
Heterozygote = 229 bp and 399 bp
Wild type = 399 bp

>chr1:197002660-197003058 399bp CTGAACCAAAAGCAGACTTCC TGGTTTGTCCTCTAGCCTTTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24874 TTC CAG TCG GGA CAT CTT TG Mutant Forward A hCR1
24875 CCA ATG AGT CGA AAC CCT TC Mutant Reverse A hCR1
44628 CTG AAC CAA AAG CAG ACT TCC Wild type Forward A
44629 TGG TTT GTC CTC TAG CCT TTG Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
24874 0.50 uM
24875 0.50 uM
44628 0.50 uM
44629 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
031668 B6(SJL)-Cr2tm1(CR2,CR1)How Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
027713 C57BL/6J-Cr2tm1(CR2,CR1)How/HowJ
2 strains use this protocol