For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031644
Protocol 21916: End Point Analysis Assay - Alb<em12Mvw>-EP
Version 2.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = --
Heterozygote = CC/--
Wild type = CC
Sequence
TTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACC(CC/--)AGCCTGCCA
CCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACAgtgagtacccagacatctacactttatgctaaaaactgggcaatagctccgtt
agtaacacttatgctgatagtcatgaaaaccccaagcatccaacaccaagtctgggaat
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 25280 | CAA AAC AAG AGC CCG AAA GA | Forward | A | |||
| 25281 | CTC TGG CCT TTC AAA TGG TG | Reverse | A | |||
| 25282 | Fluorophore-1 | TGA CAA CCC CAG CCT GC | Quencher-1 | WT Probe | ||
| 25283 | Fluorophore-2 | ATG ACA ACC AGC CTG CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 25280 | 0.40 uM |
| 25281 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.