Protocol 32479: Probe Assay - Srsf6<em1(IMPC)J> - Alt1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr2:162933755+162933873 119bp TGCTTTGGATAAACTGGATGG GCCCTCGTTACCTGGATCTAC

Mut= 126 bp

Wt= 119 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence: (deleted region in lower case)

 

CGGAAGCCATGACGACAGCAGCCTTTTGCCATTAGACGCAGGGTGATGGTGAGGATTCCAAGGGTTAGACAAAACTGGTTAATCTGAACTAGGTGACTGTTACCTTGCGTGTTTTGTGGCCAAACCACCACCAAAAACCTCACACTGTGATGTAAGTACTTAGTGTAACTAGTAAACATTTTTGTAAAATGTAGAAATGCATGTAATCAGTTAAGTTTTATATTTTACAATGTTCTGTAAAATAAAACTTAGCGAGGTAAATTGAATAAAGGAGCAGTCACTCTCTAACAGattgtaggagaggtttagttggatttagtctatttgacttgcccttaatttaatttgtggcaaatcacaaatgtatcgagggtttagcagtataatagcaaagtcctactccagtaataaacgttgctatgtttgtactaactttcaaaaacatgcatgcctgtcattgcaacgcatctaattactcccttcatgtgataaaggtggtggaggtggatacagcagtcggagaacttctggcagagacaaatatggaccacctgttcgtacagagtacaggcttattgtagaaaatctgtctagtcgttgcagttggcaagacttaaaggtatgtacctggggttttaaagacagagcagttactttccttaagagttggctacgtggtcttgctttagatttctggagcttatcagtcttaactgttttaggatttcatgcggcaagcaggagaagtgacttatgcagatgctcacaaagaacgaacaaatgagggtgtgattgaatttagatcctactccgacatgaagcgtgctttggataaactggatggtacagaaataaatggcagaaatattaggcttattgaagataagccaagaacaagccataggcgctcctactctggcagtagatccaggtaacgagggctggggggaggcttgtcatttccagttgttgcctagttgtatttacggtgtttcttggttgtagtaagcagatattctagccacagATGGGTAGTTAAAACATATTCCTTTTTTTTTTTTAAGATTTATTTATATATTTATTTATTATATGTGAGTGCACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATTTTGTAACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCAGAAGAGCAGTCGGTGCTCTTAACCTCTGAGCCATCTCACCAGCCCCCTAAAACATATTCTTGAAAAGATTAAAACATCACTGTCTCTTGTGTGTAGATCACG

This mutation is a 736 bp deletion beginning at Chromosome 2 positive strand position 162,933,223 bp and ending after 162,933,958 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
38126 TGC TTT GGA TAA ACT GGA TGG Wild type Forward A
38127 GCC CTC GTT ACC TGG ATC TAC Wild type Reverse A
38128 AGA AAT GCA TGT AAT CAG TTA AGT TTT Mutant Forward A
38129 AAA AAG GAA TAT GTT TTA ACT ACC C Mutant Reverse A
38131 Fluorophore-1 AAA GGA GCA GTC ACT CTC TAA CAG AT Quencher-1 MUT Probe
39197 Fluorophore-2 AGA ACA AGC CAT AGG CGC TCC TA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
38126 0.40 uM
38127 0.40 uM
38128 0.40 uM
38129 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.