Protocol 31900: Probe Assay - Zpld1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr16:55251612-55251694 83bp TCTGGCACTGAATGGAAGAC TGAAAATGACCACTGCTGGA

Mut= 80 bp

Wt= 83 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence: (deleted region in lower case)

 

TGTTTAGCAAATTGTATCTTATATCTTGGGTATCCTAGGTTTGGGGCTAATATCCACTTATCAGTGAGTAGTTACTCTGGTTCTAAATGTTCTCGGTAATCTGATTTCAGCACTCAGTTCTTCTGTCATTCAGCAGGGGAAGGCTGGCGTGCGTATCCTTTGAACAGCAGGCTCAAGGAAACAGAGGTGACACAGAATGTGTCAAAAAGTCTCCTGTCCCATACTAAATCAATGACTACCACTCTTAATAACGTGCACACTGGATAAAGACTAGAAATGAGTTACACAAAGGAGATGATAAATAAAGGAGCGAACACTTAAGTCGTTCACCTGCcctctactgtgcttttatgacttacttctgcttttatgtgtttttctgcttcagcggaaagagacatcagtgtctactgtggagtgcaggccattacgatgaagattaatttttgcacggtccttttctcgggatattcagaaacagatctggcactgaatggaagacatggggattcccactgcaggggcttcatcaataacaacacctttccagcagtggtcattttcatcattaatctcagcaccttggagggctgtggaaacaatttagtggtaagatttctatgaaatcctgtgctatacctgaggtcataaataaacaagctccagtttcacgaaataatcaggagctcaatctatcttcaggaaaaaaaattccaataaagccaaacaaatcattttcctttgcttgtttaaaggttgaactcccaaatatacaattctgtcttctgataatggttctgttgataggagcTGGGCTGGAGAGATGCATGTGCTCCGctatggtcctCTAAGCAGCGTTCTGTTAGATTGACATTGATGGGCATCTCTAACAACGAGCCATATTCTTCATGCTTCTATGGGTACCTCAGATCATAAGAATGTTTTTGTTCCTTTGCTGTGATCTAGATCTTATGACCTCATTCAGTAAGAAAGATTGAAGATAAAATGGGAAACCTGAACTCGTTTTTCATGTTTACCCTTGACTGGTAGCCATCAATATTCTGTAAAAGAAAGCTGTATCTTGTGGGAAGTTCTTCATAGTGTAGGACTGCCCATTACATTTAAAAAATGCTTATTCTATCCAGTTTTATCCATAGTATTCTGGAAGTGCCCCTTTCCAGTTATTTT

This is a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37931 TCT GGC ACT GAA TGG AAG AC Wild type Forward A
37932 TGA AAA TGA CCA CTG CTG GA Wild type Reverse A
37933 GGA GAT GAT AAA TAA AGG AGC GAA C Mutant Forward A
37934 GAT GCC CAT CAA TGT CAA TCT Mutant Reverse A
37935 Fluorophore-1 TCC CAC TGC AGG GGC Quencher-1 WT Probe
37936 Fluorophore-2 TGG GCT GGA GAG ATG CA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
37931 0.40 uM
37932 0.40 uM
37933 0.40 uM
37934 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.