Stock No: 031555
Protocol 33240: Probe Assay - Chd8 Exon3 (3' LoxP) - Probe Alternate 3
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 94 bp

Wt= 103 bp

Sequence

Wt Sequence (insertions with carrots ^^ ):

 AAGGGCAAGAGTAAGCTAAAGTGAGTGTTCCTGCTGCCCCGTGGGGTGCTGGGAACAGTACACTGCGGGATAAAGTGACTGCTCTCTGCTGCCCC^ataacttcgtatagcatacattatacgaagttat^TGGGGTGCTGGAGATAGCACACTCCTGTGAGGTTATATTCGTGTGAGC

Loxp Site 3' end of Exon 3

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39130 TCT GCT GCC CCG ATA ACT T Mutant Forward A
39132 GCT CAC ACG AAT ATA ACC TCA CA Common A
40970 Fluorophore-1 GCT GCC CCG TGG GGT Quencher-1 WT Probe
40971 Fluorophore-2 TCG TAT AGC ATA CAT TAT ACG AAG TTA TTG GG Quencher-2 MUT Probe
40972 TGG GGT GCT GGG AAC AGT A Wild type Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39130 0.40 uM
39132 0.40 uM
40972 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.