Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 144 bp
Wild Type = 150 bp
>chr4:126240200-126240349 150bp CTCATACACCCAGGAAGTGAC CCCCAATCCTAAGCAATTC
Wt Sequence (deleted region in lower case):
ATGAAAGCACCAAGATCAGGACCCTCAGTACTAGGGAGACCCTGCCCAGGAATCCCAGGCAAAGAAGAGTCCCACCCATCCTCAGAGAAGCAACTCATACACCCAGGAAGTGACTCAAGTCCatggggaaaaaaaaagctctccaagaactcggatagggatctatcacacataggcttgactcacagccaagtcaggaactttggttgcctgtagtgagtcaggaattgcttaggattggggaggactttctccaggtatggtggctgatcctgagcccagatctttttcccattggcccccaggagcgctatgaagcagcaatccagcggtcagtgaagaagacgtgggctgagatccggcaacagcgctggtcctgggcaggggccctgcaccacagctcccctggacgtaagaccagtgagtgggctggaagtgctggcagacGGGCGGGTGGGTAGGTGGGCAGGGCTGTGGACAGGAACACTATACACAAggcGGTCGGTCGTTCACTACTCCCTGCACCAGGTGTGTCTTGCTTCGTGTGACTTGTGTCTTCTGGAAT
325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
37127 | CTC ATA CAC CCA GGA AGT GAC | Common | A | |||
37128 | CCA GAA GAC ACA AGT CAC ACG | Mutant Reverse | A | |||
37129 | CCC CAA TCC TAA GCA ATT C | Wild type Reverse | A | |||
37130 | Fluorophore-1 | CAG GGC TGT GGA CAG GAA | Quencher-1 | MUT Probe | ||
37131 | Fluorophore-2 | TCG GAT AGG GAT CTA TCA CAC ATA | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
37127 | 0.40 uM |
37128 | 0.40 uM |
37129 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |