Stock No: 031326
Protocol 32332: Standard PCR Assay - Igs2<tm2Kng> Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 206 bp
Heterozygote = 206 bp and 322 bp
Wild type = 322 bp

>chr11:3145193-3145514 322bp TTCCCTTTCTGCTTCATCTTGC GGAGGAGGACAAACTGGTCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
11363 TTC CCT TTC TGC TTC ATC TTG C Wild type Forward A
36725 GGA GGA GGA CAA ACT GGT CA Wild type Reverse A
38846 AGC CTT CCC CAG AGC ATC Mutant Forward A
38847 TCC TTG GTT TTG ACG AGA GG Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
11363 0.50 uM
36725 0.50 uM
38846 0.50 uM
38847 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.