Stock No: 031321
Protocol 32276: Standard PCR Assay - Igs2<tm1Kng>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 224 bp
Heterozygote = 224 bp and 297 bp
Wild type = 297 bp

>chr11:3145193-3145489 297bp TCATGATTAGTGTTTGCCTTTG GGAGGAGGACAAACTGGTCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36725 GGA GGA GGA CAA ACT GGT CA Wild type Reverse A
38727 TCC AGA GAC AAG CGA AGA CA Mutant Forward A
38728 GCA AGT GAT AAT CCA AGT TTG TG Mutant Reverse A
38729 TCA TGA TTA GTG TTT GCC TTT G Wild type Forward A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
36725 0.50 uM
38727 0.50 uM
38728 0.50 uM
38729 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.