Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr10:128016101+128016258 158bp GGCGCAGTATATTCTCACAGAG AAAGGTGCGTTTCATCAACA
Mutant= 149 bp
Wild Type = 158 bp
Wt Sequence: GGCGCAGTATATTCTCACAGAgtaaggaatcttttttttcttttgtattttgtttgtatcttttttgtgtgtttattttataagccagagtgagttcttgcccccaagttttgaaGGtaatgttttagagtgtattattgttgatgaaacgcaccttt
Mutant Sequence: aaccctgtctcgaaaaaccaaaaaaaaaaaaaaaacaaaaaaaaaacgaacatatgtcttcccattagttaaggttttagttaaggttacattatgccctAGtaatgttttagagtgtattattgttgatgaaacgcaccttt
278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
21666 | AAC CCT GTC TCG AAA AAC CA | Mutant Forward | A | |||
36408 | GGC GCA GTA TAT TCT CAC AGA G | Wild type Forward | A | |||
36409 | AAA GGT GCG TTT CAT CAA CA | Common | A | |||
36411 | Fluorophore-1 | AGT GAG TTC TTG CCC CCA AG | Quencher-1 | WT Probe | ||
38421 | Fluorophore-2 | AGG TTT TAG TTA AGG TTA CAT TAT GCC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
21666 | 0.40 uM |
36408 | 0.40 uM |
36409 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |