Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr10:83017380+83017469 90bp GCTGGATAGCTAGAGCTTTGGT CATGGTGAGTACGCGTTACAAG
Mutant= 96 bp
Wild Type = 90 bp
Wt Sequence:gctggatagctagagctttggttgtgttacagcatccagtctaaatatccCGacactgacaaagcagtcttgtaacgcgtactcaccatg
Mutant Sequence: gctggatagctagagctttggttgtgttacagcatccagtctaaatatccCGaggttgtgttccttttttaaggtgtgtgcttacagataattgag
258 bp deletion beginning at Chromosome 10 positive strand position 83,554,686 bp GACACTGACAAAGCAGTCTT, and ending after AGGATGTTCAGACACTGCTG at 83,554,943 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35931 | GCT GGA TAG CTA GAG CTT TGG T | Common | A | |||
35932 | CAT GGT GAG TAC GCG TTA CAA G | Wild type Reverse | A | |||
35933 | CTC AAT TAT CTG TAA GCA CAC ACC | Mutant Reverse | A | |||
35934 | Fluorophore-1 | AAT ATC CCG AGG TTG TGT TCC | Quencher-1 | MUT Probe | ||
35935 | Fluorophore-2 | AAT ATC CCG ACA CTG ACA AAG C | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35931 | 0.40 uM |
35932 | 0.40 uM |
35933 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |