Protocol 31309: Probe Assay - Thap1<em1(IMPC)J> Probe Alternate 1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  114 bp

Wild Type = 145 bp

>chr8:26160596+26160740 145bp TGCACTGTCAAGTGTCTTCG AAGATAAAGAAAAGCCCCACAC

Sequence

Wt Sequence:

 

Mutant Sequence:

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35946 AAG ATA AAG AAA AGC CCC ACA C Wild type Reverse A
35948 Fluorophore-1 AGA GTC TCC TTA GGA TGG GGT AA Quencher-1 WT Probe
36603 TGC ACT GTC AAG TGT CTT CG Common A
36604 AAC CAC TAA GCC CCA ACA GT Mutant Reverse A
36605 Fluorophore-2 AGC TTC CTG AGA AAG GAT AAC AAA A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35946 0.40 uM
36603 0.40 uM
36604 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.