Protocol 31552: Probe Assay - Tm2d3<em1(IMPC)J> Probe Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  140 bp

Wild Type = 161 bp

 

>chr7:65697512+65697672 161bp CCCAGTCCATAGCCTTTTTC TCAGTTACAAGATGGCAGCTC

Sequence

Wt Sequence: gaccaggctggcttcaaactcagagctccacccgcccctgcctcccaggggttaggcgtgcaccagcatgcccagtccatagcctttttcctttaggtaaactgtatagattttttttcccctcgatgctacatacgagccttcttCctatatgaactgctaggccctaaatacagtgtttcagaaatctgggtctgttgatatcataacgagctgccatcttgtaactgattgagtttgtgctttggtcctagGATCAAGACCTCAAACCCCAGAGGAACTTCGTCATC

 

Mutant Sequence: aggggttaggcgtgcaccagcatgcccagtccatagcctttttcctttaggtaaactgtatagattttttttcccctcgatgctacatacgagccttcttCCtgatggccctggacccacctggggcatcgcttgctttcctccccttgctctggcctcacagaggtgacttgccatctggattttattctctgcttcctttcaggaagatacctgcccctt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35376 CCC AGT CCA TAG CCT TTT TC Common A
35377 TCT GTG AGG CCA GAG CAA G Mutant Reverse A
35378 TCA GTT ACA AGA TGG CAG CTC Wild type Reverse A
35380 Fluorophore-1 AGT GTT TCA GAA ATC TGG GTC TGT Quencher-1 WT Probe
37143 Fluorophore-2 CCT TCT TCC TGA TGG CCC TG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35376 0.40 uM
35377 0.40 uM
35378 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.