For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 113 bp
Wild Type = 103 bp
>chr18:84722065-84722167 103bp GAAAATTATGCGTGCGTATCC TGCTCATCTTCAGCACAGGA
Wt Sequence:gaaaattatgcgtgcgtatcctccttccctttGttatggtaaattccttaaatgcagttatgacattcttctcccacttctaatcctgtgctgaagatgagca
Mutant Sequence:ttgagaattgggaagactcactaaaacattaaaactgtatgGGttatggtaaattccttaaatgcagttatgacattcttctcccacttctaatcctgtgctgaagatgagca
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35337 | TTG AGA ATT GGG AAG ACT CAC T | Mutant Forward | A | |||
35338 | TGC TCA TCT TCA GCA CAG GA | Common | A | |||
35339 | GAA AAT TAT GCG TGC GTA TCC | Wild type Forward | A | |||
35340 | Fluorophore-1 | TGG GTT ATG GTA AAT TCC TTA AAT G | Quencher-1 | MUT Probe | ||
35341 | Fluorophore-2 | CTT CCC TTT GTT ATG GTA AAT TCC T | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35337 | 0.40 uM |
35338 | 0.40 uM |
35339 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |