Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr12:3257223-3257324 102bp CTGTTTTTCCTTTCAGCTCAGT CAGCATCACAGGAACCAAAC
Mutant= 141 bp
Wild Type = 102 bp
Wt Sequence: ctgtttttcctttcagctcagtatgagtaggtcattaatttcttgccGCtatgaagtgtggagcttataataatagttttctgtttggttcctgtgatgctg
Mutant Sequence: ctgtttttcctttcagctcagtatgagtaggtcattaatttcttgccGCtaaacagtttatcttcaaaatttgttcaataattctatgtattcaagataataaaaattaccagtggttttcctgatgcttttctccaaatg
452 bp deletion beginning at Chromosome 12 positive strand position 3,256,825 bp, ATTGTTGAGGGAGAGAGGGC, and ending after ATAAGCTCCACACTTCATAG at 3,257,276 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35260 | Fluorophore-1 | CTT GCC GCT AAA CAG TTT ATC TTC | Quencher-1 | MUT Probe | ||
35261 | CTG TTT TTC CTT TCA GCT CAG T | Common | A | |||
35262 | CAG CAT CAC AGG AAC CAA AC | Wild type Reverse | A | |||
35263 | CAT TTG GAG AAA AGC ATC AGG | Mutant Reverse | A | |||
35264 | Fluorophore-2 | CCG CTA TGA AGT GTG GAG C | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35261 | 0.40 uM |
35262 | 0.40 uM |
35263 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |