For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031016
Protocol 30708: Probe Assay - Cnot10<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:114538221-114538328 108bp TGCTGTTTGTTTCCTTGCTG GCATGCTGTTCTCAACATCG
Mutant= 120 bp
Wild Type = 108 bp
Sequence
Wt Sequence: tgctgtttgtttccttgctgttgttagagtgCAttctgcccggattgtttcagGTCCACTCGGCTGTTGAAGAGATGGATGGGTTAGACGATGTTGAGAACAGCATGC
Mutant Sequence: tgctgtttgtttccttgctgttgttagagtgCTatatgttagcatttaaagggggagaaagaatgggagaaatacataactcagtagagtgcttgccctgtgagtgtgagggcctgcatt
234 bp deletion spanning ENSMUSE00000448470 (exon 4) beginning at Chromosome 9 negative strand position 114,629,178 bp ATTCTGCCCGGATTGTTTCA, and ending after TAGATGACCTAAATCTGAGC at 114,628,945 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35241 | Fluorophore-1 | CTC AGT AGA GTG CTT GCC CTG | Quencher-1 | MUT Probe | ||
| 35242 | TGC TGT TTG TTT CCT TGC TG | Common | A | |||
| 35243 | AAT GCA GGC CCT CAC ACT | Mutant Reverse | A | |||
| 35244 | GCA TGC TGT TCT CAA CAT CG | Wild type Reverse | A | |||
| 35245 | Fluorophore-2 | AGG TCC ACT CGG CTG TTG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35242 | 0.40 uM |
| 35243 | 0.40 uM |
| 35244 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.