Protocol 32518: Separated PCR Assay - TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Transgene = ~180 bp

Wt = 349 bp

>chr14:97484687-97485035 349bp TCGTACCCTCATTCCCTCTG TGTAGGGGCAATCCATTTTC  This assay can differentiate between Tg/0 & Tg/Tg Integration site is known.

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39284 TCG TAC CCT CAT TCC CTC TG Wild type Forward A Wt F
39285 TGT AGG GGC AAT CCA TTT TC Common A, B
39286 ACC GAT AAA ACA CAT GCG TCA Transgene Forward B Tg F

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
39284 0.50 uM
39285 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
39285 0.50 uM
39286 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
031010 STOCK Gt(ROSA)26Sortm1(rtTA,EGFP)Nagy TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy Tg(Pou5f1-EGFP)1Nagy/J
031012 STOCK Gt(ROSA)26Sortm1(rtTA,EGFP)Nagy TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy/J
031011 STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy Tg(Pou5f1-EGFP)1Nagy/J
031013 STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy/J
4 strains use this protocol