For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr6:43510188-43510279 92bp GGGAAAAAGGTAGAATGTAGAGCA ACCACTCACAGACCCTTTGC
Mutant= 127 bp
Wild Type = 92 bp
Wt Sequence: gggaaaaaggtagaatgtagagcaggtagctccatatcttctccaccTCtgttcagatggactggagaagatgcaaagggtctgtgagtggt
Mutant Sequence: gggaaaaaggtagaatgtagagcaggtagctccatatcttctccaccTGggctgtataaccatgatgcattacttctttctatgaatgagatctcttagaattaggatcatgttttgtcttgttttt
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34887 | Fluorophore-1 | TGG GCT GTA TAA CCA TGA TGC | Quencher-1 | |||
34888 | GGG AAA AAG GTA GAA TGT AGA GCA | Common | A | |||
34889 | ACC ACT CAC AGA CCC TTT GC | Wild type Reverse | A | |||
34890 | AAA AAC AAG ACA AAA CAT GAT CC | Mutant Reverse | A | |||
34891 | Fluorophore-2 | CTG TTC AGA TGG ACT GGA GAA GA | Quencher-2 |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34888 | 0.40 uM |
34889 | 0.40 uM |
34890 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |