Genotyping Protocols Database
Stock No: 030898
Protocol 31543: Standard PCR Assay - App<tm1.1Aduci>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~260 bp
Heterozygote = 210 bp and ~260 bp
Wild type = 210 bp

>chr16:84965343-84965552 210bp CTGTGTGGGGGAAGCATAAG AGAGCATCCCTACAACCAAGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37114 CTG TGT GGG GGA AGC ATA AG Forward A
37115 AGA GCA TCC CTA CAA CCA AGT Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
37114 0.50 uM
37115 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
030898 B6(SJL)-Apptm1.1Aduci/J
031050 B6J(Cg)-Apptm1.1Aduci/J
032013 B6N(Cg)-Apptm1.1Aduci/J
3 strains use this protocol