For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030894
Protocol 30856: Standard PCR Assay - Ccr5<tm1Blck>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~190 bp
Heterozygote = ~190 bp and 292 bp
Wild type = 292 bp
>chr9:124040516+124040807 292bp TCGCTTCTTGCTGTCTATGG GTGTTTCACAGTCCCGGTGT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35713 | TCG CTT CTT GCT GTC TAT GG | Wild type Forward | A | |||
| 35714 | GTG TTT CAC AGT CCC GGT GT | Wild type Reverse | A | |||
| 35715 | GGA TGG ATT TTC AAG GGT CA | Mutant Forward | A | |||
| oIMR3330 | GGT TTT CCC AGT CAC GAC GTT G | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 35713 | 0.50 uM |
| 35714 | 0.50 uM |
| 35715 | 0.50 uM |
| oIMR3330 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.