Genotyping Protocols Database
Protocol 19801: End Point Analysis Assay - Prkdc<scid> End Point
Version 4.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = TAA
Wild type = TAT

amplicon = 149 bp

Sequence

 

CTGTTCCAGTTATAGATCTTTGTTTTAGGGTCATTACTTGGTTTAATGTT
TTTTAATGTAATTTGTATATGCTATTATAATAAGTAGAAAAAAATGTGTT
TTTTCCCTTAGAGTTTTGAGCAGACAATGCTGAGAAAAGGAGGATCATGG
ATTCAAGAAATAAATGTAACGGAAAAGAATTGGTATCCACAACATAAAAT
ACGCTA[t/a]GCTAAGAGAAAGTTAGCAGGGGCCAACCCAGCTGTTATAACTT
GGTAAGACTTGTGAATGCAGAATCAGTGTGTGTTCAAAAGTGCAAAGCAC
TTCACACACTTCTGAGCAGTATGGCACTTCACTGTGTAGATGGAGAAAGT
GACTCTTAGGGCGGCTTTACCCCTCCAAGCCCAGCCTGCAAGGACTGGGC

TCACACCCTTGTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14102 CAG ACA ATG CTG AGA AAA GGA G Forward A
14103 CTG CAT TCA CAA GTC TTA CCA AG Reverse A
14104 Fluorophore-1 TAA AAT ACG CTA AGC TAA GAG AAA G Quencher-1 MUT Probe
14105 Fluorophore-2 TAA AAT ACG CTA TGC TAA GAG AAA G Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14102 0.40 uM
14103 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000666 C57BL/10SnJ
001131 C3SnSmn.CB17-Prkdcscid/J
001303 NOD.CB17-Prkdcscid/J
001803 CBySmn.CB17-Prkdcscid/J
001913 B6.CB17-Prkdcscid/SzJ
002313 NOD.Cg-Emv30b Prkdcscid/Dvs
004083 NOD.129(B6)-Prkdcscid Iduatm1Clk/J
004606 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Tg(HLA-DQA1,HLA-DQB1)1Dv/SzJ
004919 B6.Cg-Fcgrttm1Dcr Tg(CAG-FCGRT)276Dcr/DcrJ
005557 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ
006609 NOD.Cg-Mcph1Tg(HLA-A2.1)1Enge Prkdcscid/DvsJ
007799 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/SzJ
009617 NOD.Cg-Mcph1Tg(HLA-A2.1)1Enge Prkdcscid Il2rgtm1Wjl/SzJ
010636 NOD.Cg-B2mtm1Unc Prkdcscid Il2rgtm1Wjl/SzJ
010816 B6;C-Ghrhrlit Prkdcscid/BmJ
011066 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CSF2)2Ygy Tg(IL3)1Ygy Tg(KITLG)3Ygy/YgyJGckRolyJ
012479 NOD.Cg-Tg(HLA-DRA*0101,HLA-DRB1*0101)1Dmz Prkdcscid Il2rgtm1Wjl/GckRolyJ
012480 NOD.Cg-Prkdcscid Il2rgtm1Wjl Hprtb-m3/EshJ
013062 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
014543 STOCK Hgftm1.1(HGF)Aveo Prkdcscid/J
014553 NOD.Cg-Hgftm1.1(HGF)Aveo Prkdcscid Il2rgtm1Wjl/J
014570 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(HLA-A/H2-D/B2M)1Dvs/SzJ
017619 NOD.Cg-Prkdcscid Tg(CAG-EGFP)1Osb/KupwJ
017620 NOD.Cg-Prkdcscid Tg(CAG-DsRed*MST)1Nagy/KupwJ
017637 NOD.Cg-Prkdcscid Il2rgtm1Wjl H2-Ab1tm1Doi Tg(HLA-DRB1)31Dmz/SzJ
017830 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(PGK1-KITLG*220)441Daw/SzJ
017917 B6.Cg-Dysfprmd Prkdcscid/J
018018 B10ScSn.Cg-Prkdcscid Dmdmdx/J
018441 B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ
018541 B6.Cg-Fcgrttm1Dcr Prkdcscid/DcrJ
021146 B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(CAG-FCGRT)276Dcr/DcrJ
021885 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl/SzJ
021937 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CAG-EGFP)1Osb/SzJ
022396 NOR.CB17(NOD)-Prkdcscid/JsdJ
023848 NOD.Cg-Prkdcscid H2-K1tm1Bpe H2-D1tm1Bpe Il2rgtm1Wjl/SzJ
024099 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/J
025216 NOD.Cg-Prkdcscid H2-Ab1em1Mvw H2-K1tm1Bpe H2-D1tm1Bpe Il2rgtm1Wjl/SzJ
026222 NOD.Cg-Prkdcscid Hprtem1Mvw Il2rgtm1Wjl/MvwJ
026263 NOD.Cg-Foxn1em1Dvs Prkdcscid Il2rgtm1Wjl/J
026497 NOD.Cg-KitW-41J Prkdcscid Il2rgtm1Wjl/WaskJ
026561 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv/SzJ
026622 NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ
026936 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv Tg(INS*)172Dvs/DvsJ
026997 NOD.Cg-Tg(CD68-EGFP)1Drg Prkdcscid Il2rgtm1Wjl/J
027905 NOD.Cg-Prkdcscid Cd274tm1Shr Il2rgtm1Wjl/J
027976 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(Ins2-HBEGF)6832Ugfm/SzJ
028615 NOD.Cg-Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl Tg(FCGRT)32Dcr/J
028616 NOD.Cg-Tg(CAG-FCGRT)276Dcr Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl/J
028654 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CSF1)3Sz/SzJ
029295 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(H2-Ea-HLA-DRB1*0401*)1Dv/SzJ
029819 NOD.Cg-Gcgem1Dvs Prkdcscid Il2rgtm1Wjl/DvsJ
030205 C3.Cg-Prkdcscid Tg(Mt1-HGF)1Gvw/GvwJ
030331 NOD.Cg-Tg(HLA-DRA*0101,HLA-DRB1*0101)1Dmz Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl/SzJ
030511 NOD.Cg-Hc1 Prkdcscid Il2rgtm1Wjl/SzJ
030547 NOD.Cg-B2mtm1Unc Prkdcscid H2dlAb1-Ea Il2rgtm1Wjl/SzJ
030610 NOD.Cg-Prkdcscid Cybbem1Hmal Il2rgtm1Wjl/HmalJ
030890 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(IL15)1Sz/SzJ
031566 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(H2-Ea-HLA-DRB1*0401*)1Dv/SzJ
031644 B6.Cg-Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr Prkdcscid /J
031900 NOD.Cg-Cmahem1Guru Prkdcscid Il2rgtm1Wjl/GuruJ
60 strains use this protocol