Genotyping Protocols Database
Protocol 19800: Probe Assay - Il2rg<tm1Wjl>-PROBE
Version 4.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut-130bp

WT-94bp

Fam=Mut

Hex=wt

Cy5=IPC

Sequence

Mutant sequence, including junction:

TTCAGGAACCCTACCAGTTTCTCATGGGATGCATTGTCAGTTCAGACCAGATGAGGCTAGCT
AATGGGCATATGCATGCCCATGTTTGGCCCATCATTCTTTTGCCTTGTAACCCTTCTCTAGGT
ACAAGGTATCTGATAATAATACATTCCAGGAGTGCAGTCACTATTTGTTCTCCAAAGAGATT
ACTTCTGGCTGTCAGATACAAAAAGAAGATATC(aagcttatcgataccgtcgacctcgagggcccctgcag
gtcaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgct
aca)
 
WT Il2rg, including junction:
 
ttcaggaaccctaccagtttctcatgggatgcattgtcagttcagaccagatgaggctagct
aatgggcatatgcatgcccatgtttggcccatcattcttttgccttgtaacccttctctagGT
ACAAGGTATCTGATAATAATACATTCCAGGAGTGCAGTCACTATTTGTTCTCCAAAGAGATT
ACTTCTGGCTGTCAGATACAAAAAGAAGATATC(cagctctaccagacatttgttgtccagctccaggacccc
cagaaaccccagaggcgagctgtacagaagctaaacctacagaatcttggtaatcgggaaagaagtagccaagagagcagg
gagcttaaagacactggagtttatagattg)

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
19475 AAG AGA TTA CTT CTG GCT GTC AG Common A
19476 Fluorophore-1 AAA GCG CCT CCC CTA CCC G Quencher-1 MUT Probe PGK
19477 CTC TGG GGT TTC TGG GG Wild type Reverse A
19478 Fluorophore-2 TGG AGC TGG ACA ACA AAT GTC TGG T Quencher-2 WT Probe
oIMR3914 ATG CTC CAG ACT GCC TTG Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
19475 0.40 uM
19477 0.40 uM
oIMR3914 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
003169 C.129S4-Il2rgtm1Wjl/J
003174 B6.129S4-Il2rgtm1Wjl/J
005557 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ
007799 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/SzJ
009617 NOD.Cg-Mcph1Tg(HLA-A2.1)1Enge Prkdcscid Il2rgtm1Wjl/SzJ
010636 NOD.Cg-B2mtm1Unc Prkdcscid Il2rgtm1Wjl/SzJ
011066 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CSF2)2Ygy Tg(IL3)1Ygy Tg(KITLG)3Ygy/YgyJGckRolyJ
012479 NOD.Cg-Tg(HLA-DRA*0101,HLA-DRB1*0101)1Dmz Prkdcscid Il2rgtm1Wjl/GckRolyJ
012480 NOD.Cg-Prkdcscid Il2rgtm1Wjl Hprtb-m3/EshJ
013062 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
014553 NOD.Cg-Hgftm1.1(HGF)Aveo Prkdcscid Il2rgtm1Wjl/J
014568 NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ
014570 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(HLA-A/H2-D/B2M)1Dvs/SzJ
017637 NOD.Cg-Prkdcscid Il2rgtm1Wjl H2-Ab1tm1Doi Tg(HLA-DRB1)31Dmz/SzJ
017830 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(PGK1-KITLG*220)441Daw/SzJ
017914 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(HLA-DRA,HLA-DRB1*0401)39-2Kito/ScasJ
018454 NOD.Cg-Rag1tm1Mom Fahem1Mvw Il2rgtm1Wjl/MvwJ
021885 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl/SzJ
021937 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CAG-EGFP)1Osb/SzJ
023848 NOD.Cg-Prkdcscid H2-K1tm1Bpe H2-D1tm1Bpe Il2rgtm1Wjl/SzJ
024099 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/J
025216 NOD.Cg-Prkdcscid H2-Ab1em1Mvw H2-K1tm1Bpe H2-D1tm1Bpe Il2rgtm1Wjl/SzJ
025730 B6.129S-Rag2tm1Fwa Cd47tm1Fpl Il2rgtm1Wjl/J
026014 NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ
026062 NOD.Cg-Rag1tm1Mom Fancaem1Dvs Il2rgtm1Wjl/SzJ
026222 NOD.Cg-Prkdcscid Hprtem1Mvw Il2rgtm1Wjl/MvwJ
026263 NOD.Cg-Foxn1em1Dvs Prkdcscid Il2rgtm1Wjl/J
026497 NOD.Cg-KitW-41J Prkdcscid Il2rgtm1Wjl/WaskJ
026561 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv/SzJ
026622 NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ
026936 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv Tg(INS*)172Dvs/DvsJ
026997 NOD.Cg-Tg(CD68-EGFP)1Drg Prkdcscid Il2rgtm1Wjl/J
027905 NOD.Cg-Prkdcscid Cd274tm1Shr Il2rgtm1Wjl/J
027976 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(Ins2-HBEGF)6832Ugfm/SzJ
028615 NOD.Cg-Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl Tg(FCGRT)32Dcr/J
028616 NOD.Cg-Tg(CAG-FCGRT)276Dcr Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl/J
028654 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CSF1)3Sz/SzJ
029295 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(H2-Ea-HLA-DRB1*0401*)1Dv/SzJ
029663 NOD.Cg-Rag1tm1Mom Dysfprmd Il2rgtm1Wjl/McalJ
029819 NOD.Cg-Gcgem1Dvs Prkdcscid Il2rgtm1Wjl/DvsJ
030331 NOD.Cg-Tg(HLA-DRA*0101,HLA-DRB1*0101)1Dmz Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl/SzJ
030442 NOD.Cg-Rag1tm1Mom Dmdmdx-4Cv Il2rgtm1Wjl/McalJ
030443 NOD.Cg-Rag1tm1Mom Sgcatm1Kcam Il2rgtm1Wjl/McalJ
030511 NOD.Cg-Hc1 Prkdcscid Il2rgtm1Wjl/SzJ
030533 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(SLC10A1)15Mvw/MvwJ
030547 NOD.Cg-B2mtm1Unc Prkdcscid H2dlAb1-Ea Il2rgtm1Wjl/SzJ
030610 NOD.Cg-Prkdcscid Cybbem1Hmal Il2rgtm1Wjl/HmalJ
030890 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(IL15)1Sz/SzJ
031566 NOD.Cg-Prkdcscid H2-Ab1tm1Doi Il2rgtm1Wjl Tg(H2-Ea-HLA-DRB1*0401*)1Dv/SzJ
031900 NOD.Cg-Cmahem1Guru Prkdcscid Il2rgtm1Wjl/GuruJ
032088 B6.129S-Rag1tm1Mom Cd47tm1Fpl Il2rgtm1Wjl/SzJ
033127 NOD.Cg-Rag1tm1Mom Flt3tm1Irl Mcph1Tg(HLA-A2.1)1Enge Il2rgtm1Wjl/J
52 strains use this protocol