For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr19:10591938-10592027 90bp AGATTTATTGGCTTTCCGTTCC CACCACATAAGGTGCTAGATGC
Mutant= 113 bp
Wild Type = 90 bp
gel was done on req 466215, no need to gel moving forward 4-13-18 ESP
Wt Sequence: agatttattggctttccgttccttgactataaagggaccaaaatCCgcaggactaagtgagatctaatgcatctagcaccttatgtggtg
Mutant Sequence: agatttattggctttccgttccttgactataaagggaccaaaatCTaaagtcatatcttcccaagtgtgttcttcctcttcttgtaaactgggactttctgtataagcctggc
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34471 | Fluorophore-1 | CAT ATC TTC CCA AGT GTG TTC TTC | Quencher-1 | MUT Probe | ||
34472 | Fluorophore-2 | ATC CGC AGG ACT AAG TGA GAT C | Quencher-2 | WT Probe | ||
34473 | AGA TTT ATT GGC TTT CCG TTC C | Common | A | |||
34474 | CAC CAC ATA AGG TGC TAG ATG C | Wild type Reverse | A | |||
34475 | GCC AGG CTT ATA CAG AAA GTC C | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34473 | 0.40 uM |
34474 | 0.40 uM |
34475 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |