For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr9:56321958+56322068 111bp TGCTCGTTAAGAAATGGCTCT TGCTACCTTCCATGTGTTTCC
Mutant= 115 bp
Wild Type = 111 bp
Wt Sequence: tgctcgttaagaaatggctcttatatgatgagtcaaagacctggacaaccccattcaTCtggtccattactagggtttccacatcacatgggaaacacatggaaggtagca
Mutant Sequence: tgctcgttaagaaatggctcttatatgatgagtcaaagacctggacaaccccattcaTCaggtaactcaagctgctagaattgcagatgtgctcaccatgctcagtcgtgacaaa
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33931 | TGC TCG TTA AGA AAT GGC TCT | Common | A | |||
33932 | TTT GTC ACG ACT GAG CAT GG | Mutant Reverse | A | |||
33933 | TGC TAC CTT CCA TGT GTT TCC | Wild type Reverse | A | |||
33934 | Fluorophore-1 | CTG GTC CAT TAC TAG GGT TTC C | Quencher-1 | |||
33935 | Fluorophore-2 | CTC AAG CTG CTA GAA TTG CAG | Quencher-2 |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33931 | 0.40 uM |
33932 | 0.40 uM |
33933 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |