Protocol 30102: Probe Assay - Phkb<em1(IMPC)J> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr8:88402130+88402304 175bp CTTGGCGCTAGCATACAGG CCACACTTAAAAGAGTTGATGGT

Mutant=  160 bp

Wild Type = 175 bp

Sequence

Wt Sequence: CTTGGCGCTAGCATACAGgtgggctgccgtctgttctcctgctaactccacgtggacgAGttttatagaattagtgctttaaaagaacactacaaagtatattttggagatcatttgatatatttgagtatagactgtatattacataacataccatcaactcttttaagtgtgg

 

Mutant Sequence: ggaggctttcttcgcatgtataaagacaactttgtgcagtatgGGttttatagaattagtgctttaaaagaacactacaaagtatattttggagatcatttgatatatttgagtatagactgtatattacataacataccatcaactcttttaagtgtgg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
33950 Fluorophore-1 AGA CAA CTT TGT GCA GTA TGG GT Quencher-1 MUT Probe
33951 Fluorophore-2 TGC CGT CTG TTC TCC TGC Quencher-2 WT Probe
33952 CTT GGC GCT AGC ATA CAG G Wild type Forward A
33953 CCA CAC TTA AAA GAG TTG ATG GT Common A
33954 GGA GGC TTT CTT CGC ATG T Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
33952 0.40 uM
33953 0.40 uM
33954 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.