Protocol 30101: Probe Assay - Polr1c<em1(IMPC)J> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:46382899-46383008 110bp ACGCTTTTCTCAAAGCCATC ACTAAAGGCGTGTGGCTCAG

Mutant=  97 bp

Wild Type = 110 bp

Sequence

Wt Sequence: acgcttttctcaaagccatcccTCtggggcaggtagggtggttcacacctatgacagtctgggctacatagtaaacattgtatcaagaatctgagccacacgcctttagt

 

Mutant Sequence: acgcttttctcaaagccatcccTCtgggagaacagctgtccccaccccacctctagtctcactgtgtacaccctcggaacacagcgctagcagcact

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
33901 ACG CTT TTC TCA AAG CCA TC Common A
33902 ACT AAA GGC GTG TGG CTC AG Wild type Reverse A
33903 AGT GCT GCT AGC GCT GTG T Mutant Reverse A
33906 Fluorophore-1 CAC ACC TAT GAC AGT CTG GGC Quencher-1 WT Probe
33907 Fluorophore-2 CCC CAC CTC TAG TCT CAC TGT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
33901 0.40 uM
33902 0.40 uM
33903 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.