Protocol 22128: Probe Assay - Ubiad1<em1(IMPC)J> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr4:147810905-147811012 108bp GAACCTTTTGCATGTTCTTGG CGCCAAGTTTGCCTTTTAGG

Mutant=  93 bp

Wild Type = 108 bp

Sequence

Wt Sequence:gaaccttttgcatgttcttggctcctctcATctctgtgtacccggagctctgggcactgtgtggctgaaacttttttttgggacaaatcctaaaaggcaaacttggcg

 

Mutant Sequence: gaaccttttgcatgttcttggctcctctcAatatggtagaggtcacctcattaccagtgatgaatttgggaacagtttgaccagggttgatgg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
33590 GAA CCT TTT GCA TGT TCT TGG Common A
33591 CGC CAA GTT TGC CTT TTA GG Wild type Reverse A
33592 CCA TCA ACC CTG GTC AAA CT Mutant Reverse A
33593 Fluorophore-1 CAC TGT GTG GCT GAA ACT TTT T Quencher-1 WT Probe
33594 Fluorophore-2 TCT TGG CTC CTC TCA ATA TGG T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
33590 0.40 uM
33591 0.40 uM
33592 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.