For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030544
Protocol 32622: Probe Assay - Npy1r<tm1(cre/GFP)Rpa> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 143 bp
Wild Type = 163 bp
>chr8:69227789+69227952 164bp CTGTCCATTTATCTAATCGGTAACA AGGTGAATATCACAGCCAAGG
Sequence
Wt Sequence:ttctctgcccccctcaatatacttagtaatgcaactggcctcttttgttgacagAGTATTCAGTTCAAGggAATGAAGAACTGAGAATTATCTTGGTGAATGGATTCAAATATATGGAATAAGAGTATGCTGAAGATTTGATCCGTTTTGAAGAACTATAACTGTCCATTTATCTAATCGGTAACAACAAAAcaTAAAAAAATGAACTCAACTCTGTTCTCCAAGGTTGAAAATCACTCAATTCACTATAATgcCTCAGAGAATTCTCCACTTCTGGCTTTTGAAAATGATGACTGCCACCTGCCCTTGGCTGTGATATTCACCTTGGCTCTCGCTTATGGGGCGGTGATTATTCT
Mutant Sequence: ATAACTGTCCATTTATCTAATCGGTAACAACAAAACtgtttaaactcgagatttgctctagaactagtaattcaacGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCggaataggaacttcgTTggatctcgagcaaatgtcgactctagcgctaccggactcagatctaccatggagcaaaagctgatttctgaggaggatctgggaggacccaagaagaagaggaaggtgtccaatttac
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39583 | CTG TCC ATT TAT CTA ATC GGT AAC A | Common | A | |||
| 39584 | TCG ACA TTT GCT CGA GAT CC | Mutant Reverse | A | |||
| 39585 | AGG TGA ATA TCA CAG CCA AGG | Wild type Reverse | A | |||
| 39586 | Fluorophore-1 | AGG AAC TTC GGA ATA GGA ACT TCG T | Quencher-1 | MUT Probe | ||
| 39587 | Fluorophore-2 | CTC CAC TTC TGG CTT TTG AAA ATG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39583 | 0.40 uM |
| 39584 | 0.40 uM |
| 39585 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.