Protocol 32622: Probe Assay - Npy1r<tm1(cre/GFP)Rpa> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  143 bp

Wild Type = 163 bp

>chr8:69227789+69227952 164bp CTGTCCATTTATCTAATCGGTAACA AGGTGAATATCACAGCCAAGG

Sequence

Wt Sequence:ttctctgcccccctcaatatacttagtaatgcaactggcctcttttgttgacagAGTATTCAGTTCAAGggAATGAAGAACTGAGAATTATCTTGGTGAATGGATTCAAATATATGGAATAAGAGTATGCTGAAGATTTGATCCGTTTTGAAGAACTATAACTGTCCATTTATCTAATCGGTAACAACAAAAcaTAAAAAAATGAACTCAACTCTGTTCTCCAAGGTTGAAAATCACTCAATTCACTATAATgcCTCAGAGAATTCTCCACTTCTGGCTTTTGAAAATGATGACTGCCACCTGCCCTTGGCTGTGATATTCACCTTGGCTCTCGCTTATGGGGCGGTGATTATTCT

 

Mutant Sequence: ATAACTGTCCATTTATCTAATCGGTAACAACAAAACtgtttaaactcgagatttgctctagaactagtaattcaacGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCggaataggaacttcgTTggatctcgagcaaatgtcgactctagcgctaccggactcagatctaccatggagcaaaagctgatttctgaggaggatctgggaggacccaagaagaagaggaaggtgtccaatttac

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39583 CTG TCC ATT TAT CTA ATC GGT AAC A Common A
39584 TCG ACA TTT GCT CGA GAT CC Mutant Reverse A
39585 AGG TGA ATA TCA CAG CCA AGG Wild type Reverse A
39586 Fluorophore-1 AGG AAC TTC GGA ATA GGA ACT TCG T Quencher-1 WT Probe
39587 Fluorophore-2 CTC CAC TTC TGG CTT TTG AAA ATG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39583 0.40 uM
39584 0.40 uM
39585 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.