Genotyping Protocols Database
Protocol 19966: End Point Analysis Assay - Dmd<mdx-4Cv> EP Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =T/T
Heterozygote = C/T
Wild type = C/C

Sequence

tacatgtgcaatgacgtttagattctaaatttccactgtcttctcttgagtaataattactg
ttctttattcttatttttattccagTTGAAAGAATTCAGATTCAGTGGGATGAGGTTCAAGA
ACAGCTGCAGAACAGGAGA(c/t)AACAGTTGAATGAAATGTTAAAGGATTCAACACAATGGC
TGGAAGCTAAGGAAGAAGCCGAACAGGTCATAGGACAGGTCAGAGGCAAGCTTGACTCATG
GAAAGAAGGTCCTCACACAGTAGATGCAATCCAAAAGAAGATCACAGAAA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
29091 Fluorophore-1 AGA ACA GGA GAC AAC AGT TGA ATG A Quencher-1 WT Probe
29092 Fluorophore-2 CTG CAG AAC AGG AGA TAA CAG T Quencher-2 MUT Probe
29573 TCA GAT TCA GTG GGA TGA GG Forward A
29574 TCC TTA GCT TCC AGC CAT TG Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
29573 0.40 uM
29574 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
023535 B6.Cg-Terctm1Rdp Dmdmdx-4Cv/BlauJ
002378 B6Ros.Cg-Dmdmdx-4Cv/J
030442 NOD.Cg-Rag1tm1Mom Dmdmdx-4Cv Il2rgtm1Wjl/McalJ
3 strains use this protocol