Protocol 32402: Probe Assay - Abca7 KI (A1541G) - Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut=112 bp

Wt=112 bp

Sequence

Wt Sequence (bp changes in brackets with wt first):

 CATGCCCACAGCATCACTACACTCAACCATCCTTTGAACTTGACCAAGGAGCAGCTATCTGAAG(c/g)TACACTGTGAGTCCATCCATTTACTATCAGTGGTCATGTTGCTCAGG

A1541G GCT>GGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39014 CAT GCC CAC AGC ATC ACT AC Forward A
39015 CCT GAG CAA CAT GAC CAC TG Reverse A
39016 Fluorophore-1 AGG TAC ACT GTG AGT CCA TCC A Quencher-1 MUT Probe
39018 Fluorophore-2 TGA AGC TAC ACT GTG AGT CCA TC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39014 0.40 uM
39015 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.