Protocol 30170: Standard PCR Assay - Igs7<tm143.1(tetO-RCaMP1.07)Hze>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 200 bp
Heterozygote = 200 bp and 297 bp
Wild type = 297 bp

>chr9:21349660+21349956 297bp CTGTGTAGCCCTGGCTTTTC GAAGAGTAAAAACGCACTCTGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
30772 CTG TGT AGC CCT GGC TTT TC Wild type Forward A
31040 TGC TAG CCA TAC CAT GAT GA Mutant Reverse A
34011 GAA GAG TAA AAA CGC ACT CTG C Wild type Reverse A
34028 GAA CGA GAT CAG CAG CCT CT Mutant Forward A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
30772 0.50 uM
31040 0.50 uM
34011 0.50 uM
34028 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.