Protocol 30167: Standard PCR Assay - Gt(ROSA)26Sor<tm1(JAG1)Xin>-alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 113 bp
Heterozygote = 113 bp and 198 bp
Wild type = 198 bp

>chr6:113025908-113026105 198bp CTGGCTTCTGAGGACCG CCGAAAATCTGTGGGAAGTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21306 CTG GCT TCT GAG GAC CG Wild type Forward A
34022 CGA GGA CTA TGA GGG CAA GA Mutant Forward A JAG1
34023 CTT CAG GTG TGT CGT TGG AAG Mutant Reverse A JAG1
oIMR9021 CCG AAA ATC TGT GGG AAG TC Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
21306 0.50 uM
34022 0.50 uM
34023 0.50 uM
oIMR9021 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.