For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 029928
Protocol 37962: Probe Assay - Htt<tm-human Exon1>-Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 57 bp
Wild Type = 54 bp
>chr5:34761907+34761960 54bp ATGGCAACCCTGGAAAAGC CTGAAACGACTTGAGCGACT
Sequence
Wt Sequence:
ATGGCAACCCTGGAAAAGCTGATGAAGGCTTTCGAGTCGCTCAAGTCGTTTCAG
Mutant Sequence:
ATGGCAACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52342 | CTG AAA CGA CTT GAG CGA CT | Wild type Reverse | A | |||
| 52343 | CTG CTG GAA GGA CTT GAG G | Mutant Reverse | A | |||
| 52636 | ATG GCA ACC CTG GAA AAG C | Common | A | |||
| 52637 | Fluorophore-1 | TGA TGA AGG CTT TCG AGT CG | Quencher-1 | WT Probe | ||
| 52638 | Fluorophore-2 | ATG AAG GCC TTC GAG TCC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52342 | 0.40 uM |
| 52343 | 0.40 uM |
| 52636 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.