Stock No: 029910
Protocol 19963: Sanger sequencing Assay - Plcg2 P522R-SEQ
Version 1.0

Notes

Mut = G
 
WT= C
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

tctggtactgggactcctgaacccctgccttaggactcctggaaacagccatcaatgagttgtcaggagagggcag
agcgagctgtaataagccctttcggatgcttGTGGCTCAGGACACTC(c/g)CCCCACGGAGCTGCATTTTGGGGAGA
AATGGTTCCACAAGAAGGTGGAGAGTAGGACCAGTGCGGAGAAGCTGCTGCAAGAGTACTGTGCTGAGACCGGGG
CCAAGGACG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
29567 GGC CTA GTT CAG GCT TCT GG Forward
29568 AGT CAT TGG GGA AGG TCT CG Reverse

Strains Using This Protocol

Stock Number Strain Name
029598 B6.Cg-Plcg2em1Msasn/J
029910 B6.Cg-Plcg2em2Adiuj/J
2 strains use this protocol