For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 029721
Protocol 37037: Probe Assay - Pvalb<tm1(cre)Arbr> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 85 bp
Wild Type = 89 bp
chr15:78191610-78191698 89bp GCAGAATTCTCCACTCTGGTG GACTGAGATGGGGCGTTG
Sequence
Wt Sequence:
Mutant Sequence:
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50343 | TCT AAT TCC ATC AGA AGC TGG T | Mutant Forward | A | |||
| 50344 | GAC TGA GAT GGG GCG TTG | Common | A | |||
| 50345 | GCA GAA TTC TCC ACT CTG GTG | Wild type Forward | A | |||
| 50346 | Fluorophore-1 | AAA AGC TTC TGC TTG GGT CCC C | Quencher-1 | MUT Probe | ||
| 50347 | Fluorophore-2 | AAG TGG CGC TGA CTG CTT GG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50343 | 0.40 uM |
| 50344 | 0.40 uM |
| 50345 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.