For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut= 90 bp
Wt= 91 bp
Wt Sequence: ATCCCTATCAGAGGATTGCACCCCAGGCcAAcgCCGAAGGTCACCAGCCAC
Mutant Sequence: ATCCCTATCAGAGGATTGCACCCCAGGC(-)AAcgCCGAAGGTCACCAGCCAC
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
30546 | CTA CCT GGG CTC ACC TCA CT | Forward | A | |||
30547 | GTA GAT GGG CTT TGG GAA GA | Reverse | A | |||
30548 | Fluorophore-1 | CAG GCC AAC GCC GAA GGT | Quencher-1 | |||
30549 | Fluorophore-2 | CAG GCA ACG CCG AAG GTC | Quencher-2 |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
30546 | 0.40 uM |
30547 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |