Stock No: 029311
Protocol 32753: End Point Analysis Assay - Lhcgr<tm1.1Pnara> EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =GGA/GGA
Heterozygote = GAC/GGA
Wild type = GAC/GAC

Sequence

ATCTGTGCTTGCTACGTTAGGATATACTTTGCAGTTCAAAATCCAGAGCTGACGGCTCCTAACAAGGACACAAAAATTGCTAAGAAG

ATGGCCATCCTCATCTTCACA(GAC/GGA)TTCACATGCATGGCACCCATCTCATTCTTTGCCATCTCAGCTGCCTTCAAAGTACCCCTT

ATCACTGTCACCAACTCAAAAGTTCTGCTGGTCCTTTTTTATCCTGTCAATTCTTGTGCCAACCCATTTCTGTACGCAGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39898 Fluorophore-1 GCT GAG ATG GCA AAG AAT GAG Quencher-1 Reverse A
39899 Fluorophore-2 GAC GGC TCC TAA CAA GGA CA Quencher-2 Forward A
39901 Fluorophore-3 CTT CAC AGA CTT CAC ATG CAT GGC Quencher-3 WT Probe
39902 Fluorophore-4 CTT CAC AGG ATT CAC ATG CAT GGC Quencher-4 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39898 0.40 uM
39899 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.