Stock No: 029269
Protocol 20949: Sanger sequencing Assay - Tg(MAPT*A152T)
Version 1.0

Notes

Mut = A (JR 28979)

WT= G (JR 29269)

Mouse wt will not amplify

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

CAAAAAAGCCAAGGGGGCTGATGGTAAAACGAAGATC(g/a)

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
31386 GGG CTC TGA AAC CTC TGA TG Transgene Forward A
31387 GAT CCC CTG ATT TTG GAG GT Transgene Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
31386 0.50 uM
31387 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
029269 C57BL/6-Tg(tetO-MAPT)32Lms/J
028979 C57BL/6-Tg(tetO-MAPT*A152T)L1Lms/J
2 strains use this protocol