For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 029256
Protocol 30499: Standard PCR Assay - Tradd<tm1.1Mak>-Alternate 1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 246 bp
Heterozygote = 246 bp and 152 bp
Wild type = 152 bp
>chr8:107783077-107783228 152bp TGCTCACTCACCTCTTGCTC GAGGGCAGGATCTCTCAGTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34754 | GTT GGG GGT TGG GAG AGT AG | Mutant Forward | A | |||
| 34755 | TTA GTT GCA CTC CAG CAG CTC | Mutant Reverse | A | |||
| 34756 | TGC TCA CTC ACC TCT TGC TC | Wild type Forward | A | |||
| 34757 | GAG GGC AGG ATC TCT CAG TG | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 34754 | 0.50 uM |
| 34755 | 0.50 uM |
| 34756 | 0.50 uM |
| 34757 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.