Stock No: 029233
Protocol 35759: Sanger sequencing Assay - Tyr<c-2J>-SEQ
Version 1.0

Notes

Mut = T

WT= G

>chr7:94641468-94641778 311bp AGAACTTGTTGGCAAAAGAATG CTTTTCGGAGACACTCAAATCA

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

ATGTTCTTGGCTGTTTTGTATTGCCTTCTGTGGAGTTTCCAGATCTCTGATGGCCATTTTCCTCGAGCCTGTGCCTCCTCTAAGAACTTGTTGGCAAAAGAATGCTGCCCACCATGGATGGGTGATGGGAGTCCCTGCGGCCAGCTTTCAGGCAGAGGTTCCTGCCAGGATATCCTTCTGTCCAGTGCACCATCTGGACCTCAGTTCCCCTTCAAAGGGGTGGATGACC[g/t]TGAGTCCTGGCCCTCTGTGTTTTATAATAGGACCTGCCAGTGCTCAGGCAACTTCATGGGTTTCAACTGCGGAAACTGTAAGTTTGGATTTGGGGGCCCAAATTGTACAGAGAAGCGAGTCTTGATTAGAAGAAACATTTTTGATTTGAGTGTCTCCGAAAAGAATAAGTTCTTTTCTTACCTCACTTTAGCAAAACATAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
46959 AGA ACT TGT TGG CAA AAG AAT G Forward A
46960 CTT TTC GGA GAC ACT CAA ATC A Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
46959 0.50 uM
46960 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
036153 B6.Cg-Gt(ROSA)26Sorem7Mvw Tyrc-2J/MvwJ
029233 B6.Cg-Kittm1.1Sraf/Mmjax
033605 B6.Cg-S1pr1tm4.1Rlp Gt(ROSA)26Sortm2.1(luc*/Arrb2*)Rlp Tyrc-2J/J
023428 B6;129X1-Tyrc-2J Cdkn1atm2Hpw/J
027662 C57BL/6-Tyrc-Brd Tg(Gnrhr-luc/EGFP)D8Mrln/J
026622 NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ
6 strains use this protocol