Protocol 35414: Standard PCR Assay - Tg(Thy1-SNCA)15Mjff-Chr 11
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Transgene = ~250 bp

Wt = 329 bp

>chr11:40463572-40463900 329bp GCATGATCCTGAGACGGACT TGCTCTGGGCTCCATTTC    
This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 11.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

 


 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27563 CTT TCT CTG AGT GGC AAA GGA Transgene Forward A Thy1
45999 CCA CAC CCT GTT TGG TTT TC Transgene Reverse A SNCA
46000 GCA TGA TCC TGA GAC GGA CT Wild type Forward A Mat2b
46001 TGC TCT GGG CTC CAT TTC Wild type Reverse A Mat2b

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
27563 0.50 uM
45999 0.50 uM
46000 0.50 uM
46001 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
029124 C57BL/6N-Gbatm1.1Mjff Tg(Thy1-SNCA)15Mjff/J
025533 C57BL/6N-Sncatm1Mjff Tg(Thy1-SNCA)15Mjff/J
017682 C57BL/6N-Tg(Thy1-SNCA)15Mjff/J
3 strains use this protocol