Protocol 31653: Probe Assay - Fxn<em#Lutzy>-KO Probe Alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  115 bp

Wild Type = 135 bp

>chr19:24351641-24351775 135bp TGGCTTCTAGCATTTGAACCT TGCCTGAGGTAGAAGGTGGT

Sequence

Wt Sequence:gggggtagacgtggggatcagtccctcagcactgtacctgagatgctgtaattggcTActctcgagtataggagagccaatctataaaccatgtattgctggatcagagtagacgaagatgtggtaattagtgtttttaactttggcttctagCATTTGAACCTCCACTACCTCCAGATTCTGAACATCAAAAAGCAGAGCGTCTGCGTGGTGCATTTGAGGAACTTGGGGACATTGGACAACCCAAGgtgagatgaaaccaccttctacctcaggcatgccttccacttcctctctcctcatatggaaaccatttctccctgggaacaaccttgagtgacgtctttcacatcactaagcatcccccaTGttaccttaggtgaatggtgttactgtgtgactatcccaggcttcctttagttcattcctatggttggatatt

 

Mutant Sequence: TAGCAGGAAGTCAGGGAGGACCCAGAGCAAAACTTTGGGGGTAGACGTGGGGATCAGTCCCTCAGCACTGTACCTGAGATGCTGTAATTGGCTcattaatccataacttcgtataatgtatgctatacgaagttatccagGTTACCTTAGGTGAATGGTGTTACTGTGTGACTATCCCAGGCTTCCTTTAGTTCAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36836 GTC CCT CAG CAC TGT ACC TG Mutant Forward A
36837 TCA CAC AGT AAC ACC ATT CAC CT Mutant Reverse A
36839 Fluorophore-1 TGC TGT AAT TGG CTC ATT AAT CCA TAA C Quencher-1 MUT Probe
37347 TGG CTT CTA GCA TTT GAA CCT Wild type Forward A
37348 TGC CTG AGG TAG AAG GTG GT Wild type Reverse A
37349 Fluorophore-2 CTT GGG GAC ATT GGA CAA CCC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
36836 0.40 uM
36837 0.40 uM
37347 0.40 uM
37348 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
029100 B6.Cg-Fxnem2.1Lutzy Tg(Ckmm-cre)5Khn/J
030218 B6.Cg-Pvalbtm1(cre)Arbr Fxnem2.1Lutzy/J
030395 STOCK Fxnem2.1Lutzy Tg(FXN)YG8Pook/800J
030930 STOCK Fxnem2.1Lutzy Tg(FXN)YG8Pook/J
4 strains use this protocol