For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 029018
Protocol 19965: End Point Analysis Assay - Plcg2 P522R-EP
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = G/G
Heterozygote = C/G
Wild type = C/C
Sequence
tctggtactgggactcctgaacccctgccttaggactcctggaaacagccatcaatgagttgtcaggagagggcag
agcgagctgtaataagccctttcggatgcttGTGGCTCAGGACACTC(c/g)CCCCACGGAGCTGCATTTTGGGGAGA
AATGGTTCCACAAGAAGGTGGAGAGTAGGACCAGTGCGGAGAAGCTGCTGCAAGAGTACTGTGCTGAGACCGGGG
CCAAGGACG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 29569 | AAT AAG CCC TTT CGG ATG CT | Forward | A | |||
| 29570 | TCC GCA CTG GTC CTA CTC TC | Reverse | A | |||
| 29571 | Fluorophore-1 | AGG ACA CTC CCC CCA CG | Quencher-1 | WT Probe | ||
| 29572 | Fluorophore-2 | AGG ACA CTC GCC CCA CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 29569 | 0.40 uM |
| 29570 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.