Genotyping Protocols Database
Stock No: 029018
Protocol 19965: End Point Analysis Assay - Plcg2 P522R-EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = G/G
Heterozygote = C/G
Wild type = C/C

Sequence

tctggtactgggactcctgaacccctgccttaggactcctggaaacagccatcaatgagttgtcaggagagggcag
agcgagctgtaataagccctttcggatgcttGTGGCTCAGGACACTC(c/g)CCCCACGGAGCTGCATTTTGGGGAGA
AATGGTTCCACAAGAAGGTGGAGAGTAGGACCAGTGCGGAGAAGCTGCTGCAAGAGTACTGTGCTGAGACCGGGG
CCAAGGACG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
29569 AAT AAG CCC TTT CGG ATG CT Forward A
29570 TCC GCA CTG GTC CTA CTC TC Reverse A
29571 Fluorophore-1 AGG ACA CTC CCC CCA CG Quencher-1 WT Probe
29572 Fluorophore-2 AGG ACA CTC GCC CCA CG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
29569 0.40 uM
29570 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
029018 B6.Cg-Apoeem2(APOE*)Adiuj/J
029598 B6.Cg-Plcg2em1Msasn/J
030771 B6;SJL-Apoetm1.1(APOE*4)Adiuj Plcg2em1Msasn Trem2em1Adiuj/J
3 strains use this protocol