Genotyping Protocols Database
Stock No: 029017
Protocol 20170: Sanger sequencing Assay - Apoe<tm1.1(APOE*4)Msasn-E4/E3/E2-Alternate 1
Version 1.0

Notes

E4= GC/C = Mut JR 27894/28709

E2= CT/T = Mut JR 29017

E3= CT/C = JR 29018

B6 wt mouse will have no PCR product

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

CCCGGCTGGGCGCGGACATGGAGGACGT(gc/ct)GCGGCCGCCTGGTGCAGTACCGCGG

CGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCC

CACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG(c/t)GC

CTGGCAGTGTACCAGGCCGGGGCCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24459 CCC CGG CCT GGT ACA CTG Reverse A
29961 ACG GCT GTC CAA GGA GCT G Forward A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
24459 0.50 uM
29961 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
028709 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J
029017 B6.Cg-Apoeem3(APOE*)Adiuj/J
029018 B6.Cg-Apoeem2(APOE*)Adiuj/J
3 strains use this protocol