For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 029017
Protocol 20170: Sanger sequencing Assay - Apoe<tm1.1(APOE*4)Msasn-E4/E3/E2>-Alternate 1
Version 1.0
Notes
E4= GC/C = Mut JR 27894/28709
E2= CT/T = Mut JR 29017
E3= CT/C = JR 29018
B6 wt mouse will have no PCR product
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
>chr19:44908623+44908846 224bp ACGGCTGTCCAAGGAGCTG CCCCGGCCTGGTACACTG
ACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGT(gc/ct)GCGGCCGCCTGGTGCAGTACCGCGG
CGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCC
CACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG(c/t)GC
CTGGCAGTGTACCAGGCCGGGGCCC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24459 | CCC CGG CCT GGT ACA CTG | Reverse | A | |||
| 29961 | ACG GCT GTC CAA GGA GCT G | Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 24459 | 0.50 uM |
| 29961 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.