For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 113 bp
Wild Type = 110 bp
Wt Sequence: gttggaagccctggaagtccaggaccaaaaggccaaaagggggaccatggagacaatagaggtaagagaatgccttagaatgattagcttgagtgcaggtatgtgtccga
Mutant Sequence: ATCTGGCCGTCTGTGAGTTCCCTATCTGAtagtaagtcgacgaagttcctatactttctagagaataggaacttcctcgagaccgtacggaaacgagtgcctccatat
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
32743 | GTT GGA AGC CCT GGA AGT C | Wild type Forward | A | |||
32744 | TCG GAC ACA TAC CTG CAC TC | Wild type Reverse | A | |||
32745 | Fluorophore-1 | GGG GGA CCA TGG AGA CA | Quencher-1 | WT Probe | ||
32746 | ATC TGG CCG TCT GTG AGT TC | MUT Probe | A | |||
32747 | ATA TGG AGG CAC TCG TTT CC | Mutant Reverse | A | |||
32749 | Fluorophore-2 | AGA GAA TAG GAA CTT CCT CGA GAC C | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
32743 | 0.40 uM |
32744 | 0.40 uM |
32746 | 0.40 uM |
32747 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |