Protocol 36020: Probe Assay - Slc32a1<tm2(cre)Lowl> Probe-Alternate 3
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  96 bp

Wild Type = 82 bp

>chr2:158614981+158615062 82bp TACCGAACCAACGCAGAGG GGGAATGACGGGGAGTGG

 

 

Sequence

Wt Sequence: CTACCGAACCAACGCAGAGGACTAGGGGGTGGGGACCCTGCCCCCAGCTCCATCCCCGCCCACCCCCACTCCCCGTCATTCCCGCCCCCACCCCCACTCCCAGCCTCCTGCGCCGTCGCGCTAGGGAGGCCGAGCTTTAA

 

Mutant Sequence: CTACCGAACCAACGCAGAGGACTAGGGGaatTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13007 ACA CCG GCC TTA TTC CAA G Mutant Reverse A
45508 Fluorophore-1 TAG GGG AAT TCC GCC Quencher-1 MUT Probe
47594 TAC CGA ACC AAC GCA GAG G Common A
47595 GGG AAT GAC GGG GAG TGG Wild type Reverse A
47596 Fluorophore-2 CTG CCC CCA GCT CCA TCC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
13007 0.40 uM
47594 0.40 uM
47595 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.