Genotyping Protocols Database
Stock No: 028856
Protocol 32456: End Point Analysis Assay - Cdkl5<tm2.1Joez> EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =T/T
Heterozygote = C/T
Wild type = C/C

>chrX:157303890-157303990 101bp TCTAGAAAATGAAGAAGTCAAGGAG GACGAAAAGCTTCCTTCAGC

Sequence

tagAAAATGAAGAAGTCAAGGAGACGACCTTA(c/t)GAGAGCTTAAAATGCTTCGCACTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39150 TCT AGA AAA TGA AGA AGT CAA GGA G Forward A
39151 GAC GAA AAG CTT CCT TCA GC Reverse A
39152 Fluorophore-1 CGA CCT TAC GAG AGC TTA AAA TGC T Quencher-1 WT Probe
39153 Fluorophore-2 CGA CCT TAT GAG AGC TTA AAA TGC T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39150 0.40 uM
39151 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.