For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 028856
Protocol 32456: End Point Analysis Assay - Cdkl5<tm2.1Joez> EP
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =T/T
Heterozygote = C/T
Wild type = C/C
>chrX:157303890-157303990 101bp TCTAGAAAATGAAGAAGTCAAGGAG GACGAAAAGCTTCCTTCAGC
Sequence
tagAAAATGAAGAAGTCAAGGAGACGACCTTA(c/t)GAGAGCTTAAAATGCTTCGCACTC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39150 | TCT AGA AAA TGA AGA AGT CAA GGA G | Forward | A | |||
| 39151 | GAC GAA AAG CTT CCT TCA GC | Reverse | A | |||
| 39152 | Fluorophore-1 | CGA CCT TAC GAG AGC TTA AAA TGC T | Quencher-1 | WT Probe | ||
| 39153 | Fluorophore-2 | CGA CCT TAT GAG AGC TTA AAA TGC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39150 | 0.40 uM |
| 39151 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.