Stock No: 028123
Protocol 22055: End Point Analysis Assay - Tbk1<em8(N22D)Lutzy>alternate1
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = G/G
Heterozygote = A/G
Wild type = A/A

Sequence

GAGCACCTCCAACCATCTGTGGCTCCTGTCTGATATCCTAGGCCAGGGGGCCACTGCA(a/g)AT
GTCTTCCGAGGAAGGCATAAGgtaggtccagtgctgcctgtcaggctcatctcgacc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24890 Fluorophore-1 GCC ACT GCA AAT GTC TTC C Quencher-1 WT Probe
24891 Fluorophore-2 GCC ACT GCA GAT GTC TTC C Quencher-2 MUT Probe
25187 AAC CAT CTG TGG CTC CTG TC Forward A
25188 AGC ACT GGA CCT ACC TTA TGC Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
25187 0.40 uM
25188 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.