Stock No: 027983
Protocol 22050: End Point Analysis Assay - Tbk1<em#1(R228H)Lutzy>
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = AT/AT
Heterozygote = GG/AT
Wild type = GG/GG

Sequence

CATCCGGACATGTATGAAAGGGCAGTGCTAAGAAAGGACCATCAGAAGAAGTACGGGGCTAC
CGTTGATCTGTGGAGTGTTGGAGTGACATTCTACCATGCAGCCACGGGGTCGCTGCCGTTTAG
ACCCTTCGAGGGGCCtC(g/a)(g/t)AGGAACAAAGAAGTAATgtaagcacctctgcgtctgccgt
tagacggggtttctgatgtgtgtgtgtatcttgtttatccagatgtgtgaggagatgaaattga
tgaaaattggcttttctaatactttatgcttcctgtgagtataat

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24600 GGG TCG CTG CCG TTT AGA Forward A
24601 GCA GAC GCA GAG GTG CTT AC Reverse A
24608 Fluorophore-1 GGG CCT CGG AGG AAC A Quencher-1 WT Probe
24609 Fluorophore-2 AGG GGC CTC ATA GGA ACA AA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
24600 0.40 uM
24601 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.