For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 027286
Protocol 37918: Probe Assay - Shox2<tm1Ddu>-Probe Alt1
Version 2.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:66973328-66973421 94bp GGGACTAAAATTCGGCTTTG GGCGCTATCCACTTCTCACT
Mut= 118 bp
Wt= 94 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence:
CCTTGGGACTAAAATTCGGCTTTGTAGGAGCGGGTTTGGGGAAGTCTGGATAgaGACTGGACAAAGGAGTGTGGCCACAGTGAGAagtggatagcgccacagcTGCGGCGATGGACTCGTTCATAG
Mutant Sequence:
AATTCGGCTTTGTAGGAGCGGGTTTGGGGAAGTCTGGATAGTTAATTAAGAATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTGGATCCAGACTGGACAAAGGAGTGTGGCCACAGTGAGAAGTGGATAGCGCCACAGCTGCGGCGATGGACTCGTTCATAGGAATAAAATCTTGCTAACAGCAAATGAGCAAAAACAAAAAAGAATAGAGAACAAACTAGAAAGAAAACGAGAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52110 | GGG ACT AAA ATT CGG CTT TG | Wild type Forward | A | |||
| 52111 | GGC GCT ATC CAC TTC TCA CT | Common | A | |||
| 52112 | TAG GAA CTT CAT CAG TCA GGT ACA | Mutant Forward | A | |||
| 52114 | Fluorophore-1 | AAG TCT GGA TAG AGA CTG GAC AAA G | Quencher-1 | WT Probe | ||
| 52115 | Fluorophore-2 | ATG CTA TAC GAA GTT ATT AGG TGG ATC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52110 | 0.40 uM |
| 52111 | 0.40 uM |
| 52112 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.